187. Repeated DNA Sequences

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

Example:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Output: ["AAAAACCCCC", "CCCCCAAAAA"]

Approach #1: C++.

class Solution {
public:
    vector<string> findRepeatedDnaSequences(string s) {
        vector<string> ans;
        vector<int> appear((1<<20)+1, 0);
        int len = s.length();
        for (int i = 0, j = 9; j < len; ++i, ++j) {
            int value = 0;
            for (int k = i; k <= j; ++k) {
                value = (value << 2) + helper(s[k]);
            }
            appear[value]++;
            if (appear[value] == 2) {
                ans.push_back(s.substr(i, 10));
            }
        }
        return ans;
    }
    
private:
    int helper(char c) {
        if (c == 'A') return 0;
        else if (c == 'C') return 1;
        else if (c == 'G') return 2;
        else return 3;
    }
};

　　

Approach #2: Java.

class Solution {
    public List<String> findRepeatedDnaSequences(String s) {
        Set seen = new HashSet(), repeated = new HashSet();
        for (int i = 0; i+9 <s.length(); ++i) {
            String ten = s.substring(i, i+10);
            if (!seen.add(ten))
                repeated.add(ten);
        }
        return new ArrayList(repeated);
    }
}

　　

Approach #3: Python.

class Solution(object):
    def findRepeatedDnaSequences(self, s):
        """
        :type s: str
        :rtype: List[str]
        """
        sequences = collections.defaultdict(int) #set '0' as the default value for non-existing keys
        for i in range(len(s)):
            sequences[s[i:i+10]] += 1#add 1 to the count
        return [key for key, value in sequences.iteritems() if value > 1] #extract the relevant keys

　　

Time Submitted	Status	Runtime	Language
a few seconds ago	Accepted	92 ms	python
9 minutes ago	Accepted	39 ms	java
12 minutes ago	Accepted	56 ms	cpp

Analysis:

hash[key] = value.

key represent hash key which don't have the repeated element, we can use value = (value << 2) + helper(s[i]) to generate.