axt alignment format

  axt Alignment Format       

axt alignment files are produced from Blastz, an alignment tool available from Webb Miller's lab at Penn State University. The axtNet and axtChain alignments are produced by processing the alignment files with additional utilities written by Jim Kent at UCSC. Example: The following segment from an axt file shows the first 2 sets of alignments of the human assembly (the aligning assembly) to mouse chromsome 19 (the primary assembly).     0 chr19 3001012 3001075 chr11 70568380 70568443 - 3500 TCAGCTCATAAATCACCTCCTGCCACAAGCCTGGCCTGGTCCCAGGAGAGTGTCCAGGCTCAGA TCTGTTCATAAACCACCTGCCATGACAAGCCTGGCCTGTTCCCAAGACAATGTCCAGGCTCAGA 1 chr19 3008279 3008357 chr11 70573976 70574054 - 3900 CACAATCTTCACATTGAGATCCTGAGTTGCTGATCAGAATGGAAGGCTGAGCTAAGATGAGCGACGAGGCAATGTCACA CACAGTCTTCACATTGAGGTACCAAGTTGTGGATCAGAATGGAAAGCTAGGCTATGATGAGGGACAGTGCGCTGTCACA Structure Each alignment block in an axt file contains three lines: a summary line and 2 sequence lines. Blocks are separated from one another by blank lines. 1. Summary line     0 chr19 3001012 3001075 chr11 70568380 70568443 - 3500 The summary line contains chromosomal position and size information about the alignment. It consists of 9 required fields: Alignment number -- The alignment numbering starts with 0 and increments by 1, i.e. the first alignment in a file    is numbered 0,  the next 1, etc. Chromosome (primary organism) Alignment start (primary organism) -- The first base is numbered 1. Alignment end (primary organism) -- The end base is included. Chromosome (aligning organism) Alignment start (aligning organism) Alignment end (aligning organism) Strand (aligning organism) -- If the strand value is "-", the values of the aligning organism's start and end fields are relative to the reverse-complemented    coordinates of its chromosome. Blastz score -- Different blastz scoring matrices are used for different organisms. See the README.txt file in the alignments directory for scoring information specific to a pair of alignments. 2. & 3. Sequence lines     TCAGCTCATAAATCACCTCCTGCCACAAGCCTGGCCTGGTCCCAGGAGAGTGTCCAGGCTCAGA TCTGTTCATAAACCACCTGCCATGACAAGCCTGGCCTGTTCCCAAGACAATGTCCAGGCTCAGA The sequence lines contain the sequence of the primary assembly (line 2) and aligning assembly (line 3) with inserts. Repeats are indicated by lower-case letters.